Last Reviewed June 2, 2009
Definition
Clinical (medical) genetic testing involves analyzing a person's DNA, RNA, chromosomes, proteins, or metabolites obtained from a sample of blood, hair, skin or other tissue in order to confirm a diagnosis of a genetic condition, identify carriers of a genetic condition, or to determine a person's predisposition to a particular health condition.
Many different methods and laboratory techniques are used in genetic testing, and the clinical testing method used largely depends on the goal of the testing. "Molecular genetic testing" generally refers to techniques that directly analyze specific DNA or RNA sequences. Other common clinical genetic testing methods include cytogenetic testing (used to diagnose chromosomal abnormalities, such as the presence of an extra chromosome or deletion of a chromosomal segment); biochemical tests (used to detect characteristic biochemical markers of a specific genetic condition - for example, to diagnose PKU or galactosemia); and simple blood (hematologic) tests (used, for example, to diagnose sickle-cell disease).
Some of the more common genetic testing techniques are listed below:
Molecular Genetic Testing:
Direct DNA Sequencing
Direct DNA sequencing techniques have advanced dramatically during the past decade. Though many different strategies are employed, most clinical laboratories still rely on "dideoxy" chain-termination technologies originally developed in the 1970's to read the order of nucleotides (A's, T's, G's, and C's) that make up a DNA sequence. Dideoxy (also known as Sanger-based) methods are most effectively used in the analysis of specific, short DNA segments - for example, for the diagnosis of a specific mutation.
- In this method, a double-stranded DNA sample is first heated to form two complementary DNA single strands.
- One of the single-stranded "templates" is then bound (hybridized) to a short, complementary "primer" sequence.
- A polymerase enzyme extends the primer by attaching individual A's, T's, C's, and G's in the reaction mixture in an order that is complementary to the template sequence.
- Small quantities of dye-labeled *A's, *T's, *C's, and *G's are also added to the reaction mixture. These so-called "dideoxy nucleotides" are chemically modified in such a way that when added they stop the polymerase primer extension.
Because (1) the extension reaction is carried out simultaneously on thousands of template molecules, and (2) the incorporation of dideoxy nucleotides is random, a series of complementary DNA fragments that differ in size by just a single base is produced, where each fragment ends with a labeled nucleotide. These fragments can be separated according to their size, and the identity of the terminal, labeled nucleotide is then read.
Emerging "next-generation" technologies are driving the transformation of the field of genetics, offering the possibility of large-scale whole genome-wide sequencing studies that would have been unthinkable just a couple of years ago. For example, several of these platforms are already being used in the 1,000 Genomes Project, which is an international project to sequence the entire genomes of about 1,200 people worldwide in order to provide insight into medically relevant genetic variations.
Coupled with new strategies for massive data storage and analysis, these technologies are enabling researchers to construct a detailed map of human genetic variation. The "holy grail" of all these sequencing efforts is to provide a $1,000 genome - that is, the complete sequence of the about 6.4 billion DNA bases that make up an individual human being for $1,000 or less. The Archon X Prize for Genomics hopes to help speed up this process. According to their website, "the $10 million X PRIZE for Genomics prize purse will be awarded to the first Team that can build a device and use it to sequence 100 human genomes within 10 days or less, with an accuracy of no more than one error in every 100,000 bases sequenced, with sequences accurately covering at least 98% of the genome, and at a recurring cost of no more than $10,000 per genome."
Short-Tandem Repeat Sequencing (STRs)
Short-tandem repeats (STRs) are short sequences of DNA, typically 2 to 5 base pairs in length, that are repeated numerous times along the DNA sequence. STRs are found at many locations within the human genome, and vary in length from one individual to the next. For example, at a specific cite along the DNA sequence the four-base-pair STR "C-A-T-A" may appear three times for one individual (•••CATACATACATA•••), and five times for another (•••CATACATACATACATACATA•••). These repeating units are easily amplified, and the number of repeats can be readily determined from small amounts of genetic material. Each individual has a unique pattern of STRs, thus STR sequencing has become the preferred forensic genetic testing method to uniquely identify individuals based on DNA analysis.
Cytogenetic Tests:
Chromosome Analysis
Chromosome analysis (also known as a karyotype) generally refers to the study of the number and basic structure of the 46 human chromosomes. In a standard analysis, the chromosomes of a dividing cell are stained and visually inspected under a microscope. The chromosomes are counted to establish that there are no extra or missing chromosomes, and their structures are examined to ensure that large segments of DNA are neither missing (deletions) nor duplicated. In some cases, rearrangements of genetic material, such as a chromosome inversion or translocation may also be detected. A standard karyotype can only detect gross chromosomal lesions and cannot detect specific DNA changes (mutations).
FISH (fluorescence in situ hybridization)
The FISH assay features short DNA probe sequences that are labeled with a dye that glows (fluoresces) under UV light. These labeled DNA probes bind only to specific regions within the genome and can therefore indicated small chromosomal duplications or deletions. FISH is often used in prenatal genetic testing, and is particularly effective at diagnosing more subtle chromosomal abnormalities that are not detected by traditional karyotyping.
Comparative Genome Hybridization
As in the FISH assay, comparative genome hybridization (CGH) involves hybridizing short DNA probe sequences to complementary sequences of chromosomal DNA found in a test subject's dividing cells. In this test, however, the assay is carried out side-by-side with the hybridization of identically labeled probe sequences to the DNA of a control set of normally dividing cells. Differences in the yield of probe hybridization to the subject vs. control chromosomes indicates the existence of either deletions (lower yield) or duplications (higher yield) of genetic material in the sample. These deletions and/or duplications are referred to as changes in the chromosomal "copy number."
- This technique is not suitable for detecting small copy-number changes or SNPs, as the deletion or duplication must be at least about 1 million bases long to be detected. This technique does not detect balanced chromosome rearrangements, such as balanced inversions or balanced translocations, in which there is no gain or loss of DNA.
- This technique can be beneficial as it requires no prior knowledge of the abnormality. This testing is also useful in analyzing cancer cells to classify tumor type.